• JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
  • JoomlaWorks Simple Image Rotator
 
  Bookmark and Share
 
 
Mémoire de Maîtrise
DOI
10.11606/D.6.2017.tde-21122016-103103
Document
Auteur
Nom complet
Ana Tereza Galvani
Adresse Mail
Unité de l'USP
Domain de Connaissance
Date de Soutenance
Editeur
São Paulo, 2016
Directeur
Jury
Razzolini, Maria Tereza Pepe (Président)
Ekman, Luciana Regina Meireles Jaguaribe
Sato, Maria Inês Zanoli
Titre en portugais
Quantificação  de oocistos de Toxoplasma gondii em amostras de águas superficiais no Estado de São Paulo
Mots-clés en portugais
Água
DNA
Oocistos
qPCR
Toxoplasma gondii
Resumé en portugais
Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo.
Titre en anglais
Quantification of Toxoplasma gondii oocysts in surface water samples in São Paulo
Mots-clés en anglais
DNA
Oocysts
qPCR
Toxoplasma gondii
Water
Resumé en anglais
Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5' TAGTATCGTGCGGCAATGTG 3' (531-551) and 5'GGCAGCGTCTCTTCCTCTTTT 3' (571-592) were used. The probe employed was 5 '(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.
 
AVERTISSEMENT - Regarde ce document est soumise à votre acceptation des conditions d'utilisation suivantes:
Ce document est uniquement à des fins privées pour la recherche et l'enseignement. Reproduction à des fins commerciales est interdite. Cette droits couvrent l'ensemble des données sur ce document ainsi que son contenu. Toute utilisation ou de copie de ce document, en totalité ou en partie, doit inclure le nom de l'auteur.
AnaTerezaGalvani.pdf (2.13 Mbytes)
Date de Publication
2017-01-23
 
AVERTISSEMENT: Apprenez ce que sont des œvres dérivées cliquant ici.
Tous droits de la thèse/dissertation appartiennent aux auteurs
CeTI-SC/STI
Bibliothèque Numérique de Thèses et Mémoires de l'USP. Copyright © 2001-2021. Tous droits réservés.